Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EXO1

Gene ID (NCBI) 9156
Gene Symbol EXO1
Protein Name exonuclease 1
Synonyms HEX1|hExoI
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K10746)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081223 IRAL003A23 pOTB7 BC007491 NM_130398 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR462687 RBdS156L23 pGCAP10 NM_003686.3  
GAGCCTTTCGCGCGCTGTGTAGGCAAGTTGCCCGTGTTCTGCGTTGCCGGCCGTGGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl