Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156L23

Clone ID RBdS156L23
HP ID HP09246
Gene ID 9156
Gene Symbol EXO1
Protein Name exonuclease 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003686.3
Length of RefSeq (bp) 3138
Chromosome 1q42-q43
Reference DDBJ accession
UniGene Hs.498248
5'-terminal sequence GAGCCTTTCGCGCGCTGTGTAGGCAAGTTGCCCGTGTTCTGCGTTGCCGGCCGTGGGTGC
2011.08.28