Prev. |  KEGG KO K02146 > 

RIKEN DNA Bank Human Resource - ATP6V0D1

Gene ID NCBI Gene 9114 |  KEGG hsa:9114
Gene Symbol ATP6V0D1
Protein Name ATPase H+ transporting V0 subunit d1
Synonyms ATP6D|ATP6DV|P39|VATX|VMA6|VPATPD
Ortholog resources KEGG ortholog (KEGG orthology K02146) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090565 IRAL026G21 pOTB7 BC008861 NM_004691 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072151 ARe80G07 pKA1U5 NM_004691.4  
GGACCTGGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCCGCTCCCG
HKR186426 ARi66B02 pGCAP10 NM_004691.4  
TGCCCCCCGCCGCTCCCGCAGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTTAACGTGG
HKR276719 ARiS191N07 pGCAP10 NM_004691.4  
GGGGGNCTGACNTGNGGANNNNNGNTTGTNGCCCGCCNGTNNNGGTTCTGNNGTCCNNCC
HKR276763 ARiS191P03 pGCAP10 NM_004691.4  
GGTCAGCTGACCTGGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCC
HKR373673 RBd34D01 pGCAP10 NM_004691.4  
GGCACTTGACAGCCCGCTGAGGACGCAGCGTCAGCTGACCTGGGGAGTCGCGATTCGTGC
HKR428200 RBdS070I08 pGCAP10 NM_004691.4  
GGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCCGCTCCCGCAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl