Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP6V0D1

Gene ID (NCBI) 9114
Gene Symbol ATP6V0D1
Protein Name ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Synonyms ATP6D|ATP6DV|P39|VATX|VMA6|VPATPD
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY090565 IRAL026G21 pOTB7 BC008861 NM_004691 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186426 ARi66B02 pGCAP10 NM_004691.4  
TGCCCCCCGCCGCTCCCGCAGCAGCCATGTCGTTCTTCCCGGAGCTTTACTTTAACGTGG
HKR072151 ARe80G07 pKA1U5 NM_004691.4  
GGACCTGGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCCGCTCCCG
HKR276719 ARiS191N07 pGCAP10 NM_004691.4  
GGGGGNCTGACNTGNGGANNNNNGNTTGTNGCCCGCCNGTNNNGGTTCTGNNGTCCNNCC
HKR276763 ARiS191P03 pGCAP10 NM_004691.4  
GGTCAGCTGACCTGGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCC
HKR373673 RBd34D01 pGCAP10 NM_004691.4  
GGCACTTGACAGCCCGCTGAGGACGCAGCGTCAGCTGACCTGGGGAGTCGCGATTCGTGC
HKR428200 RBdS070I08 pGCAP10 NM_004691.4  
GGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCCGCTCCCGCAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl