Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070I08

Clone ID RBdS070I08
HP ID HP00356
Gene ID 9114
Gene Symbol ATP6V0D1
Protein Name ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004691.4
Length of RefSeq (bp) 1688
Chromosome 16q22
Reference DDBJ accession
UniGene Hs.106876
5'-terminal sequence GGGGAGTCGCGATTCGTGCCGGCCGGTCCTGGTTCTCCGGTCCCGCCGCTCCCGCAGCAG
2011.08.28