Prev. |  KEGG KO K12396 > 

RIKEN DNA Bank Human Resource - AP3D1

Gene ID NCBI Gene 8943 |  KEGG hsa:8943
Gene Symbol AP3D1
Protein Name adaptor related protein complex 3 delta 1 subunit
Synonyms ADTD|HPS10|hBLVR
Ortholog resources KEGG ortholog (KEGG orthology K12396) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082845 IRAL007B21 pOTB7 BC005142 NM_003938 Partial/var
HGY091091 IRAL027M03 pOTB7 BC010065 NM_003938 Partial/var
HGY097040 IRAL042J24 pOTB7 BC022837 NM_003938 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072174 ARe80H06 pKA1U5 NM_003938.5  
GGTCCGCCATTTGCAAGGGGCCCGGAGCGGGATCGCGGCACCTGCCGAGCGGGTCGCCGC
HKR342101 RBb55E05 pGCAP1 NM_003938.5  
GGTCCGCCATTTGCAAGGGGCCCGGAGCGGGATCGCGGCACCTGCCGAGCGGGTCGCCGC
HKR416191 RBdS040H23 pGCAP10 NM_003938.5  
GGTCCGCCATTTGCAAGGGGCCCGGAGCGGGATCGCGGCACCTGCCGAGCGGGTCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl