Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS040H23

Clone ID RBdS040H23
HP ID HP06256
Gene ID 8943
Gene Symbol AP3D1
Protein Name adaptor-related protein complex 3, delta 1 subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003938.5
Length of RefSeq (bp) 4863
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.512815
5'-terminal sequence GGTCCGCCATTTGCAAGGGGCCCGGAGCGGGATCGCGGCACCTGCCGAGCGGGTCGCCGC
2011.08.28