Prev. |  KEGG KO K12394 > 

RIKEN DNA Bank Human Resource - AP1S2

Gene ID NCBI Gene 8905 |  KEGG hsa:8905
Gene Symbol AP1S2
Protein Name adaptor related protein complex 1 sigma 2 subunit
Synonyms DC22|MRX59|MRXS21|MRXS5|MRXSF|PGS|SIGMA1B
Ortholog resources KEGG ortholog (KEGG orthology K12394) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081342 IRAL003F22 pOTB7 BC001117 NM_003916 Full
HGY103253 IRAL058C05 pOTB7 BC071867 NM_003916 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR462702 RBdS156M14 pGCAP10 NM_003916.3  
GATGCCAGCCGGGTGTCCTCCCCACAGCACCACGGCTTCTCTTCCTCAGCACGGCGACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl