Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156M14

Clone ID RBdS156M14
HP ID HP09247
Gene ID 8905
Gene Symbol AP1S2
Protein Name adaptor-related protein complex 1, sigma 2 subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003916.3
Length of RefSeq (bp) 2283
Chromosome Xp22.2
Reference DDBJ accession
UniGene Hs.656471
5'-terminal sequence GATGCCAGCCGGGTGTCCTCCCCACAGCACCACGGCTTCTCTTCCTCAGCACGGCGACAG
2011.08.28