Prev. | 

RIKEN DNA Bank Human Resource - BANF1

Gene ID NCBI Gene 8815 |  KEGG hsa:8815
Gene Symbol BANF1
Protein Name barrier to autointegration factor 1
Synonyms BAF|BCRP1|D14S1460|NGPS
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088655 IRAL021K15 pDNR-LIB BC005942 NM_003860 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096428 M01C041B04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096476 M01C041D04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096524 M01C041F04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096572 M01C041H04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096620 M01C041J04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096668 M01C041L04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096716 M01C041N04 pDONR221 MGC10-D02 BC005942 NM_003860  
HGE096764 M01C041P04 pDONR221 MGC10-D02 BC005942 NM_003860  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040803 ARe02A03 pKA1U5 NM_003860.3  
TAGTTCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGG
HKR061635 ARe54B11 pKA1U5 NM_003860.3  
GATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTA
HKR066176 ARe65H08 pKA1U5 NM_003860.3  
GATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTA
HKR068575 ARe71H07 pKA1U5 NM_003860.3  
GAGCGGGTGTGCGCAGCGCTAGGTGTGCGCTTCNTNCTGATAGGTAGAGAGACCCTTTGG
HKR072156 ARe80G12 pKA1U5 NM_003860.3  
GGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAG
HKR078099 ARe95E03 pKA1U5 NM_003860.3  
GGGAAGAAAGTTCTAGTGGCTTGAGGTATCCGCAGGTAGCGGCCGGGTGGCGGGAGGAAC
HKR168851 ARi22C03 pGCAP10 NM_003860.3  
GAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTG
HKR172924 ARi32F04 pGCAP10 NM_003860.3  
GCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAAC
HKR178454 ARi46C06 pGCAP10 NM_003860.3  
GGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGACAACCTC
HKR179252 ARi48C04 pGCAP10 NM_003860.3  
GCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAAC
HKR182921 ARi57F01 pGCAP10 NM_003860.3  
GAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTG
HKR205260 ARiS013C12 pGCAP10 NM_003860.3  
GAGTNNNNNNNNNANTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAAC
HKR208023 ARiS020A23 pGCAP10 NM_003860.3  
GGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGA
HKR208318 ARiS020N06 pGCAP10 NM_003860.3  
GGGGNNGNNCCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAGATGACAACCTC
HKR235369 ARiS088H01 pGCAP10 NM_003860.3  
GCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAAC
HKR243861 ARiS109K21 pGCAP10 NM_003860.3  
GAGGTATCCNCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGG
HKR362104 RBd05E08 pGCAP10 NM_003860.3  
GAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTG
HKR379301 RBd48E05 pGCAP10 NM_003860.3  
GAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTG
HKR396924 RBd92F04 pGCAP10 NM_003860.3  
GGAAAGTTCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTA
HKR405546 RBdS013O10 pGCAP10 NM_003860.3  
GGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGATCAAG
HKR405828 RBdS014J12 pGCAP10 NM_003860.3  
GATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTA
HKR406086 RBdS015D14 pGCAP10 NM_003860.3  
GAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGG
HKR433382 RBdS083H14 pGCAP10 NM_003860.3  
GGGGTCCGGGCAGCAGAGAAAGGAAGTCCTCTCCCTGGAGGCCTATCTCCCTCAGAACGG
HKR474954 RBdS187G10 pGCAP10 NM_003860.3  
GAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTG
HKR475100 RBdS187M12 pGCAP10 NM_003860.3  
GGGAAGTGGAAGAAAGTTCTAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl