Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187G10

Clone ID RBdS187G10
HP ID HP10183
Gene ID 8815
Gene Symbol BANF1
Protein Name barrier to autointegration factor 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003860.3
Length of RefSeq (bp) 1179
Chromosome 11q13.1
Reference DDBJ accession
UniGene Hs.433759
5'-terminal sequence GAGTGGCTTGAGGTATCCGCAGGAGCGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTG
2011.08.28