Prev. |  KEGG KO K03870 > 

RIKEN DNA Bank Human Resource - CUL2

Gene ID NCBI Gene 8453 |  KEGG hsa:8453
Gene Symbol CUL2
Protein Name cullin 2
Synonyms -
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  CUL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088579 IRAL021H11 pDNR-LIB BC009591 NM_003591

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058884 ARe47D12 pKA1U5 NM_003591.2  
GGGCAGCAGCGGAAGAAGGAGACCGGAGGGTGTGTGTTGGGCAAAGCCGGAGGCAGAGGA
HKR461877 RBdS154L13 pGCAP10 NM_003591.2  
GGGACTTTGCTGTCTTTCCTCGCGGAGACAGATTTCAACACTACACTTGCACAATGTCTT
HKR471038 RBdS177J22 pGCAP10 NM_003591.2  
GAGGACGATTGTTTTACGGATCCCGTGATCGGCCCGTCCTTCTCCCCTTTCCCCCCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl