Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177J22

Clone ID RBdS177J22
HP ID HP05463
Gene ID 8453
Gene Symbol CUL2
Protein Name cullin 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003591.2
Length of RefSeq (bp) 2910
Chromosome 10p11.21
Reference DDBJ accession
UniGene Hs.82919
5'-terminal sequence GAGGACGATTGTTTTACGGATCCCGTGATCGGCCCGTCCTTCTCCCCTTTCCCCCCCTCC
2011.08.28