Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANP32A

Gene ID (NCBI) 8125
Gene Symbol ANP32A
Protein Name acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Synonyms C15orf1|HPPCn|I1PP2A|LANP|MAPM|PHAP1|PHAPI|PP32
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082154 IRAL005G10 pOTB7 BC000608 NM_006305
HGY087426 IRAL018J10 pOTB7 BC007200 NM_006305

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE098814 M01C047A14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE098862 M01C047C14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE098910 M01C047E14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE098958 M01C047G14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE099006 M01C047I14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE099054 M01C047K14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE099102 M01C047M14 pDONR221 MGC13-B07 BC007200 XM_940765
HGE099150 M01C047O14 pDONR221 MGC13-B07 BC007200 XM_940765

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE037394 W01A093I02 pENTR-TOPO IRAL018J10 BC007200 NM_006305
HGE037400 W01A093I08 pENTR-TOPO IRAL018J10 BC007200 NM_006305
HGE037402 W01A093I10 pENTR-TOPO IRAL018J10 BC007200 NM_006305
HGE037404 W01A093I12 pENTR-TOPO IRAL018J10 BC007200 NM_006305
HGE037408 W01A093I16 pENTR-TOPO IRAL018J10 BC007200 NM_006305
HGE045901 W01A114M13 pENTR-TOPO IRAL018J10 BC007200 NM_006305
HGE045903 W01A114M15 pENTR-TOPO IRAL018J10 BC007200 NM_006305

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR205549 ARiS013O13 pGCAP10 NM_006305.3
GGCTGGGGNNTCGNNNNCCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGG
HKR219952 ARiS049O16 pGCAP10 NM_006305.3
GGGGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTG
HKR324952 RBb12G08 pKA1U5 NM_006305.3
GGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTGGG
HKR331374 RBb28H06 pGCAP1 NM_006305.3
GGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTGGG
HKR371756 RBd29G12 pGCAP10 NM_006305.3
GATTGATTGAATTCCGCCGGCGCGGGAGCCTCTGCAGAGAGAGAGCGCGAGAGATGGAGA
HKR334454 RBb36C06 pGCAP1 NM_006305.3
TTTTGGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTGGG
HKR375280 RBd38D08 pGCAP10 NM_006305.3
GGGGGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGT
HKR375707 RBd39E11 pGCAP10 NM_006305.3
GAGTGTGCGCCGCGGGTGCTGGGGGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAA
HKR339722 RBb49F02 pGCAP1 NM_006305.3
GGAGAGAGAGAGCGCGAGAGATGGAGATGGGCAGACGGATTCATTTAGAGCTGCGGAACA
HKR376801 RBd42A01 pGCAP10 NM_006305.3
TGGGGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGT
HKR377279 RBd43D07 pGCAP10 NM_006305.3
HKR384552 RBd61G08 pGCAP10 NM_006305.3
GGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTGGGTTCG
HKR387201 RBd68A01 pGCAP10 NM_006305.3
GGCGGGTGCTGGGGGCTCGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAAC
HKR408803 RBdS022A03 pGCAP10 NM_006305.3
GGAGAACCGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTGGGTTCG
HKR432499 RBdS081E03 pGCAP10 NM_006305.3
GATTGATTGAATTCCGCCGGCGCGGGAGCCTCTGCAGAGAGAGAGCGCGAGAGATGGAGA
HKR444212 RBdS110I20 pGCAP10 NM_006305.3
GAAAGTCCTAAAACGCGCGGCCGTGGGTTCGGGGTTTATTGATTGAATTCCGCCGGCGCG
HKR444311 RBdS110M23 pGCAP10 NM_006305.3
GGATCAGGTTAGTGTGCGCCGCGGGTGCTGGGGGCTCGAGAACCGAGCGGAGCTGGTTGA
HKR462665 RBdS156L01 pGCAP10 NM_006305.3
GGGAGCGGAGCTGGTTGAGCCTTCAAAGTCCTAAAACGCGCGGCCGTGGGTTCGGGGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl