Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110M23

Clone ID RBdS110M23
HP ID HP00160
Gene ID 8125
Gene Symbol ANP32A
Protein Name acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006305.3
Length of RefSeq (bp) 2479
Chromosome 15q22.3-q23
Reference DDBJ accession
UniGene Hs.458747
5'-terminal sequence GGATCAGGTTAGTGTGCGCCGCGGGTGCTGGGGGCTCGAGAACCGAGCGGAGCTGGTTGA
2011.08.28