Prev. |  KEGG KO K09250 > 

RIKEN DNA Bank Human Resource - CNBP

Gene ID NCBI Gene 7555 |  KEGG hsa:7555
Gene Symbol CNBP
Protein Name CCHC-type zinc finger nucleic acid binding protein
Synonyms CNBP1|DM2|PROMM|RNF163|ZCCHC22|ZNF9
Ortholog resources KEGG ortholog (KEGG orthology K09250) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006001 IRAK015A01 pCMV-SPORT6 BC014911 NM_003418 Full/var
HGY080403 IRAL001A03 pOTB7 BC000288 NM_003418 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024402 W01A061A02 pENTR-TOPO flj0001o07 AK054592 NM_003418  
HGE024404 W01A061A04 pENTR-TOPO flj0001o07 AK054592 NM_003418  
HGE024408 W01A061A08 pENTR-TOPO flj0001o07 AK054592 NM_003418  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045280 ARe13D08 pKA1U5 NM_003418.4  
GATGTGGGGCCGTGNTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAG
HKR054931 ARe37F11 pKA1U5 NM_003418.4  
GAGCCTCTACCTTGCGAGCCGTCTTCCCCAGGCCTGCGTCCGAGTCTCCGCCGCTGCGGG
HKR063750 ARe59G06 pKA1U5 NM_003418.4  
GGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCG
HKR064401 ARe61A01 pKA1U5 NM_003418.4  
GAGACCCGCGTGTGGCGCAGGCAAGGAACCCTCACAATAAACAGCCTCTACCTTGCGAGC
HKR081723 ARf04F03 pKA1U5 NM_003418.4  
GAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCC
HKR176028 ARi40B04 pGCAP10 NM_003418.4  
GGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCG
HKR178479 ARi46D07 pGCAP10 NM_003418.4  
GGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCG
HKR235022 ARiS087J06 pGCAP10 NM_003418.4  
GGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTG
HKR238749 ARiS096O13 pGCAP10 NM_003418.4  
GGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCG
HKR279444 ARiS198K04 pGCAP10 NM_003418.4  
GAGACCCGCGTGTGGCCCAGGCNAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCC
HKR338573 RBb46H05 pGCAP1 NM_003418.4  
GCCCAGGCCTGCGTCCGAGTCTCCGCCGCTGCGGGCCCGCTCCGACGCGGAAGATCTGAC
HKR343778 RBb59H10 pGCAP1 NM_003418.4  
GAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCC
HKR361611 RBd04A11 pGCAP10 NM_003418.4  
GGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCCGTCTTCCCCAGG
HKR361636 RBd04B12 pGCAP10 NM_003418.4  
HKR370900 RBd27E04 pGCAP10 NM_003418.4  
GGTGCGCAGCGGCGTATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCC
HKR371204 RBd28A04 pGCAP10 NM_003418.4  
GGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTG
HKR371655 RBd29C07 pGCAP10 NM_003418.4  
GGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCG
HKR372025 RBd30B01 pGCAP10 NM_003418.4  
GAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCC
HKR372122 RBd30F02 pGCAP10 NM_003418.4  
TGGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGA
HKR372478 RBd31D06 pGCAP10 NM_003418.4  
GGTGCGCAGCGGCGTATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCC
HKR383680 RBd59D08 pGCAP10 NM_003418.4  
GGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTG
HKR384050 RBd60C02 pGCAP10 NM_003418.4  
GATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGC
HKR386154 RBd65G10 pGCAP10 NM_003418.4  
GGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCCGTCTTCCCCAGG
HKR386969 RBd67H01 pGCAP10 NM_003418.4  
GCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGC
HKR406045 RBdS015B21 pGCAP10 NM_003418.4  
GGCGCAGCGGCGTATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTC
HKR416129 RBdS040F09 pGCAP10 NM_003418.4  
GGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCT
HKR453100 RBdS132M12 pGCAP10 NM_003418.4  
GGTGCGCAGCGGCGTATGTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCAAGGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl