Prev. |  Human A to Z list >  C >  CNBP > 

RBd30B01 - NRCD Human cDNA Clone

Catalog Number HKR372025
Clone Name RBd30B01
Clone info. Plasmid clone of human CNBP cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GAGACCCGCGTGTGGCGCAGGCAAGGACCCTCAAAATAAACAGCCTCTACCTTGCGAGCC
Sequence, submitted(3) n.a.
 
Sequence, refered NM_003418.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) CNBP (NCBI Gene 7555)  other clone of CNBP in our bank
Synonyms CNBP1|DM2|PROMM|RNF163|ZCCHC22|ZNF9
Protein Name CCHC-type zinc finger nucleic acid binding protein
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR372025 RBd30B01 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd30B01 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR372025).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.03

NRCDhumcloneList_RB_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl