Prev. |  KEGG KO K10704 > 

RIKEN DNA Bank Human Resource - UBE2V2

Gene ID NCBI Gene 7336 |  KEGG hsa:7336
Gene Symbol UBE2V2
Protein Name ubiquitin conjugating enzyme E2 V2
Synonyms DDVIT1|DDVit-1|EDAF-1|EDPF-1|EDPF1|MMS2|UEV-2|UEV2
Ortholog resources KEGG ortholog (KEGG orthology K10704) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056629 IRAK141J13 pCMV-SPORT6 BC062418 NM_003350 Full
HGY086599 IRAL016I07 pDNR-LIB BC007051 NM_003350 Full
HGY092828 IRAL032B04 pDNR-LIB BC016332 NM_003350 Full
HGY092839 IRAL032B15 pDNR-LIB BC016710 NM_003350 Full
HGY092893 IRAL032D21 pDNR-LIB BC028673 NM_003350 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR218363 ARiS045P03 pGCAP10 NM_003350.2  
TGGGCTGCGTCGGGCTGCAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTA
HKR243948 ARiS109O12 pGCAP10 NM_003350.2  
GGGCTGCGTCGGGCTGCAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAA
HKR333346 RBb33G02 pGCAP1 NM_003350.2  
GGGGCTGCAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAATTTTCGCTT
HKR392031 RBd80B07 pGCAP10 NM_003350.2  
GAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAATTTTCGCTTGTTGGAA
HKR392500 RBd81E04 pGCAP10 NM_003350.2  
GGTCGGGCTGCAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAATTTTCG
HKR392906 RBd82E10 pGCAP10 NM_003350.2  
GGCGCGACGGTTCGTGCGTGCGTGCGGGCGGCTGCGTCGGGCTGCAGGAGAAGATGGCGG
HKR461735 RBdS154F15 pGCAP10 NM_003350.2  
GGGCTGCGTCGGGCTGCAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl