Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154F15

Clone ID RBdS154F15
HP ID HP00161
Gene ID 7336
Gene Symbol UBE2V2
Protein Name ubiquitin-conjugating enzyme E2 variant 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003350.2
Length of RefSeq (bp) 1535
Chromosome 8q11.21
Reference DDBJ accession
UniGene Hs.491695
5'-terminal sequence GGGCTGCGTCGGGCTGCAGGAGAAGATGGCGGTCTCCACAGGAGTTAAAGTTCCTCGTAA
2011.08.28