Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TSG101

Gene ID (NCBI) 7251
Gene Symbol TSG101
Protein Name tumor susceptibility 101
Synonyms TSG10|VPS23
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082384 IRAL005P24 pOTB7 BC002487 NM_006292 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001941 W01A004O05 pENTR-TOPO IRAL005P24 BC002487 NM_006292  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174955 ARi37G11 pGCAP10 NM_006292.2  
TGGATTGTGTGGGACGGTCTGGGGCAGCCCAGCAGCGGCTGACCCTCTGCCTGCGGGGAA
HKR184051 ARi60C03 pGCAP10 NM_006292.2  
CGGCCGGCCGATTGGTGTGGCCGACTTCCTGTTGTTTGAGGCCGGGTTGGGGGTGTGCGA
HKR321373 RBb03H05 pKA1U5 NM_006292.2  
GGCCGGGTTGGGGGTGTGCGATTGTGTGGGACNGTCTGGGGCAGCCCAGCAGCGGCTGAC
HKR380121 RBd50F01 pGCAP10 NM_006292.2  
GGGGTTGGGGGNNNGCNATTNNNNNGGACGNNCNGGGCANCNNGCACNNNTGANCNTNTG
HKR344903 RBb62E07 pGCAP1 NM_006292.2  
HKR346475 RBb66D03 pGCAP1 NM_006292.2  
GAAGGGAGTCGCCAGGCGGCCGTCATGGCGGTGTCGGAGAGCCAGCTCAAGAAAATGGTG
HKR432744 RBdS081O08 pGCAP10 NM_006292.2  
GGAGGCCGGGTTGGGGGTGTGCGATTGTGTGGGACGGTCTGGGGCAGCCCAGCAGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl