Prev. |  KEGG KO K12183 > 

RIKEN DNA Bank Human Resource - TSG101

Gene ID NCBI Gene 7251 |  KEGG hsa:7251
Gene Symbol TSG101
Protein Name tumor susceptibility 101
Synonyms TSG10|VPS23
Featured content Endocytosis (human)
Ortholog resource in our bank

  TSG101

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082384 IRAL005P24 pOTB7 BC002487 NM_006292 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001941 W01A004O05 pENTR-TOPO IRAL005P24 BC002487 NM_006292  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174955 ARi37G11 pGCAP10 NM_006292.2  
TGGATTGTGTGGGACGGTCTGGGGCAGCCCAGCAGCGGCTGACCCTCTGCCTGCGGGGAA
HKR184051 ARi60C03 pGCAP10 NM_006292.2  
CGGCCGGCCGATTGGTGTGGCCGACTTCCTGTTGTTTGAGGCCGGGTTGGGGGTGTGCGA
HKR321373 RBb03H05 pKA1U5 NM_006292.2  
GGCCGGGTTGGGGGTGTGCGATTGTGTGGGACNGTCTGGGGCAGCCCAGCAGCGGCTGAC
HKR344903 RBb62E07 pGCAP1 NM_006292.2  
HKR346475 RBb66D03 pGCAP1 NM_006292.2  
GAAGGGAGTCGCCAGGCGGCCGTCATGGCGGTGTCGGAGAGCCAGCTCAAGAAAATGGTG
HKR380121 RBd50F01 pGCAP10 NM_006292.2  
GGGGTTGGGGGNNNGCNATTNNNNNGGACGNNCNGGGCANCNNGCACNNNTGANCNTNTG
HKR432744 RBdS081O08 pGCAP10 NM_006292.2  
GGAGGCCGGGTTGGGGGTGTGCGATTGTGTGGGACGGTCTGGGGCAGCCCAGCAGCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl