Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081O08

Clone ID RBdS081O08
HP ID HP10133
Gene ID 7251
Gene Symbol TSG101
Protein Name tumor susceptibility gene 101
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006292.2
Length of RefSeq (bp) 1550
Chromosome 11p15
Reference DDBJ accession
UniGene Hs.523512
5'-terminal sequence GGAGGCCGGGTTGGGGGTGTGCGATTGTGTGGGACGGTCTGGGGCAGCCCAGCAGCGGCT
2011.08.28