Prev. |  KEGG KO K11481 > 

RIKEN DNA Bank Human Resource - AURKA

Gene ID NCBI Gene 6790 |  KEGG hsa:6790
Gene Symbol AURKA
Protein Name aurora kinase A
Synonyms AIK|ARK1|AURA|BTAK|PPP1R47|STK15|STK6|STK7
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  AURKA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001641 IRAK004B17 pCMV-SPORT6 BC001280 NM_198437 Full/var
HGX020854 IRAK052C06 pCMV-SPORT6 BC027464 NM_198437 Full/var
HGY081719 IRAL004E23 pOTB7 BC002499 NM_198437 Full/var
HGY087312 IRAL018E16 pOTB7 BC006423 NM_198437 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE015006 W01A037I14 pENTR-TOPO IRAK004B17 BC001280 NM_198437  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205406 ARiS013I14 pGCAP10 NM_003600.2  
GGGCTGAGCTCTTGGAAGACTTGGGTCCTTGGGTCGCAGGCATCATGGACCGATCTAAAG
HKR235233 ARiS088B09 pGCAP10 NM_003600.2  
TGCTTGGAAGACTTGGGTCCTTGGGTCGCAGGTGGGAGCCGACGGGCATCATGGACCGAT
HKR379332 RBd48F12 pGCAP10 NM_003600.2  
GGCTGAGCTCTTGGAAGACTTGGGTCCTTGGGTCGCAGGTGGGAGCCGACGGGTGGGTAG
HKR384949 RBd62G05 pGCAP10 NM_003600.2  
GGCTGAGCTCTTGGAAGACTTGGGTCCTTGGGTCGCAGGGTCTCACTCCATTGCCCAGGC
HKR391611 RBd79A11 pGCAP10 NM_003600.2  
GACGGCTGAGCTCTTGGAAGACTTGGGTCCTTGGGTCGCAGGCATCATGGACCGATCTAA
HKR432650 RBdS081K10 pGCAP10 NM_003600.2  
TGGAATTCTAACGGCTGAGCTCTTGGAAGACTTGGGTCCTTGGGTCGCAGGTGGGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl