Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081K10

Clone ID RBdS081K10
HP ID HP03149
Gene ID 6790
Gene Symbol AURKA
Protein Name aurora kinase A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003600.2
Length of RefSeq (bp) 2346
Chromosome 20q13.2-q13.3
Reference DDBJ accession
UniGene Hs.250822
5'-terminal sequence TGGAATTCTAACGGCTGAGCTCTTGGAAGACTTGGGTCCTTGGGTCGCAGGTGGGAGCCG
2011.08.28