Prev. |  KEGG KO K06114 > 

RIKEN DNA Bank Human Resource - SPTAN1

Gene ID NCBI Gene 6709 |  KEGG hsa:6709
Gene Symbol SPTAN1
Protein Name spectrin alpha, non-erythrocytic 1
Synonyms EIEE5|NEAS|SPTA2
Featured content Apoptosis - human
Ortholog resource in our bank

  SPTAN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX042885 IRAK107D13 pCMV-SPORT6 BC051801 NM_003127 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080826 M01C002B02 pDONR221 04-134-2_1-H01 BC053521 ENST00000372731  
HGE080874 M01C002D02 pDONR221 04-134-2_1-H01 BC053521 ENST00000372731  
HGE080922 M01C002F02 pDONR221 04-134-2_1-H01 BC053521 ENST00000372731  
HGE080970 M01C002H02 pDONR221 04-134-2_1-H01 BC053521 ENST00000372731  
HGE081018 M01C002J02 pDONR221 04-134-2_1-H01 BC053521 ENST00000372731  
HGE081066 M01C002L02 pDONR221 04-134-2_1-H01 BC053521 ENST00000372731  
HGE110411 M01C076A11 pDONR221 06-2_01-E06 BC053521 ENST00000372731  
HGE094832 M01C037B08 pDONR221 MGC08-D04 BC053521 ENST00000372731  
HGE094880 M01C037D08 pDONR221 MGC08-D04 BC053521 ENST00000372731  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058050 ARe45C02 pKA1U5 NM_001195532.2 full cds done
GACCCGCTGCGGAGTGAACGGTGTGGAGCGGAGGCCGCGGAGGCTCCTCGGTCCTTCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl