Prev. |  KEGG KO K17917 > 

RIKEN DNA Bank Human Resource - SNX1

Gene ID NCBI Gene 6642 |  KEGG hsa:6642
Gene Symbol SNX1
Protein Name sorting nexin 1
Synonyms HsT17379|VPS5
Ortholog resources KEGG ortholog (KEGG orthology K17917) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080743 IRAL001O07 pOTB7 BC000357 NM_003099 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR019305 ARa48E09 pKA1U5 NM_003099.3  
TGGCGGGTGGAAGAAGATGGCGTCGGGTGGTGGTGGCTGTAGCGCTTCGGAGAGACTGCC
HKR420487 RBdS051D15 pGCAP10 NM_003099.3  
GCGCGGGTGGAAGAAGATGGCGTCGGGTGGTGGTGGCTGTAGCGCTTCGGAGAGACTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl