Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051D15

Clone ID RBdS051D15
HP ID HP04501
Gene ID 6642
Gene Symbol SNX1
Protein Name sorting nexin 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003099.3
Length of RefSeq (bp) 8221
Chromosome 15q22.31
Reference DDBJ accession
UniGene Hs.188634
5'-terminal sequence GCGCGGGTGGAAGAAGATGGCGTCGGGTGGTGGTGGCTGTAGCGCTTCGGAGAGACTGCC
2011.08.28