Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PVRL2

Gene ID (NCBI) 5819
Gene Symbol PVRL2
Protein Name poliovirus receptor-related 2 (herpesvirus entry mediator B)
Synonyms CD112|HVEB|PRR2|PVRR2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082536 IRAL006F16 pOTB7 BC003091 NM_002856 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE007212 W01A018A12 pENTR-TOPO IRAL006F16 BC003091 NM_002856

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162101 ARi05E05 pGCAP10 NM_002856.2 done
GGAACCGCCGGAGCTGAGCGAGAGGCCGGGGGTGCCGAGCCGGGCGGGGAGAGCTGGGCC
HKR066009 ARe65A09 pKA1U5 NM_002856.2 done
GCGGGCGGGGAGAGCTGGGCCGGGAGAGCAGAACAGGGTAGGCTAGAGCGCAGCGGGAAC
HKR071346 ARe78G02 pKA1U5 NM_002856.2 done
GGCGAGAGGCCGGGGGTGCCGAGCCGGGCGGGGAGAGCTGGGCCGGGAGAGCAGAACAGG
HKR243936 ARiS109N24 pGCAP10 NM_002856.2 done
GGGGAGAGCAGAACAGGGAGGCTAGAGCGCAGCGGGAACCGGCCCGGAGCCGGAGCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl