Prev. |  Human A to Z list >  N >  NECTIN2 > 

ARiS109N24 - NRCD Human cDNA Clone

Catalog Number HKR243936
Clone Name ARiS109N24
Clone info. Plasmid clone of human PVRL2 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGGGAGAGCAGAACAGGGAGGCTAGAGCGCAGCGGGAACCGGCCCGGAGCCGGAGCCGGA
Sequence, submitted(3) n.a.
Note 3' terminus corresponds NM_001042724.1.
 
Sequence, refered NM_002856.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) NECTIN2 (NCBI Gene 5819)  other clone of NECTIN2 in our bank
Synonyms CD112|HVEB|PRR2|PVRL2|PVRR2
Protein Name nectin cell adhesion molecule 2
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR243936 ARiS109N24 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARiS109N24 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR243936).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
ARiS109N24a.seq   ARiS109N24c.seq   ARiS109N24.pdf

References and tips

Featured content

Reference


2023.07.07

NRCDhumcloneList_AR_2023May03.csv - GNP_filter3_NRCD_html_230707.pl