Prev. |  KEGG KO K04369 > 

RIKEN DNA Bank Human Resource - MAP2K2

Gene ID NCBI Gene 5605 |  KEGG hsa:5605
Gene Symbol MAP2K2
Protein Name mitogen-activated protein kinase kinase 2
Synonyms CFC4|MAPKK2|MEK2|MKK2|PRKMK2
Featured content MAP kinases (human)
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Apoptosis - human
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  MAP2K2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080679 IRAL001L15 pOTB7 BC000471 NM_030662.4 Full/var
HGY090332 IRAL025N20 pOTB7 BC018645 NM_030662 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046805 W01A117A05 pENTR-TOPO IRAL025N20 BC018645 NM_030662  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044436 ARe11B12 pKA1U5 NM_030662.2  
GCTGCCTCTCGGACTCGGGCTGCGGCGTCAGCCTTCTTCGGGCCTCGGCAGCGGTAGCGG
HKR056173 ARe40H05 pKA1U5 NM_030662.2  
GCTCTCGGACTCGGGCTGCGGCGTCAGCCTTCTCCNTGNCTCGGCAGCGGTAGCGGCTCG
HKR167774 ARi19H06 pGCAP10 NM_030662.2  
GCCCTCCCCTCCCCCTGCCTCTCGGACTCGGGCTGCGGCGTCCGCCTTCTTCGGGCCTCG
HKR169655 ARi24C07 pGCAP10 NM_030662.2  
GGCCCCTCCCCTCCCCCTGCCTCTCGGACTCGGGCTGCGGCGNNNNCCTTCTTCGGGCCT
HKR334577 RBb36H09 pGCAP1 NM_030662.2  
GCTGCCTCTCGGACTCGGGCTGCGGCGTCAGCCTTCTTCGGGCCTCGGCAGCGGTAGCGG
HKR405673 RBdS014D01 pGCAP10 NM_030662.2  
GGCTCCCCCTGCCTCTCGGACTCGGGCTGCGGCGTCAGCCTTCTTCGGGCCTCGGCAGCG
HKR475017 RBdS187J01 pGCAP10 NM_030662.2  
GGGTCAGCCTTCTTCGGGCCTCGGCAGCGGTAGCGGCTCGCTCGCCTCAGCCCCAGCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl