Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187J01

Clone ID RBdS187J01
HP ID HP03766
Gene ID 5605
Gene Symbol MAP2K2
Protein Name mitogen-activated protein kinase kinase 2
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_030662.2
Length of RefSeq (bp) 1759
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.465627
5'-terminal sequence GGGTCAGCCTTCTTCGGGCCTCGGCAGCGGTAGCGGCTCGCTCGCCTCAGCCCCAGCGCC
2011.08.28