Prev. |  KEGG KO K04371 > 

RIKEN DNA Bank Human Resource - MAPK3

Gene ID NCBI Gene 5595 |  KEGG hsa:5595
Gene Symbol MAPK3
Protein Name mitogen-activated protein kinase 3
Synonyms ERK-1|ERK1|ERT2|HS44KDAP|HUMKER1A|P44ERK1|P44MAPK|PRKM3|p44-ERK1|p44-MAPK
Ortholog resources KEGG ortholog (KEGG orthology K04371) in the DNA Bank
Featured content MAP kinases (human)
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082453 IRAL006C05 pOTB7 BC000205 NM_002746 Partial
HGY091283 IRAL028D11 pOTB7 BC013992 NM_002746 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023435 W01A058J19 pENTR-TOPO IRAL028D11 BC013992 NM_002746  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR373609 RBd34A09 pGCAP10 NM_001040056.1  
AGGGGGAGGAGGGCGGTGGGAGGGGAGGAGTGGAGATGGCGGCGGCGGCGGCTCAGGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl