DNA Bank Top |  KEGG KO K04371 > 

RIKEN DNA Bank Human Resource - MAPK1

Gene ID NCBI Gene 5594 |  KEGG hsa:5594
Gene Symbol MAPK1
Protein Name mitogen-activated protein kinase 1
Synonyms ERK|ERK-2|ERK2|ERT1|MAPK2|NS13|P42MAPK|PRKM1|PRKM2|p38|p40|p41|p41mapk|p42-MAPK
Featured content MAP kinases (human)
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Apoptosis - human
Featured content Alzheimer disease - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  MAPK1


External database

human MAPK1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14156 pCMV-GFP-ERK2 Expression vector of GFP-tagged human ERK2.    
RDB14152 pGEX-GFP-ERK2-His Bacterial expression vector of GFP–human ERK2.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094641 IRAL036K01 pDNR-LIB BC017832 NM_138957.3 full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE048076 W01A120D04 pENTR-TOPO IRAL036K01 BC017832 NM_138957  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079304 ARe98E08 pKA1U5 NM_002745.4  
GGTCAGTCTGGCAGGCAGGCAGGCAATCGGTCCGAGTGGCTGTCGGCTCTTCAGCTCTCC
HKR264579 ARiS161H11 pGCAP10 NM_002745.4  
GAGTCTGNNNGNAGGNNNNCNNTCGGTCCNAGTGGCTGNCGGCTCTTCAGCTCTCCCGCT
HKR398033 RBd95B09 pGCAP10 NM_002745.4 done
GGCCCGCCGGCCCGCCCGTCAGTCTGGCAGGCAGGCAGGCAATCGGTCCGAGTGGCTGTC
HKR430292 RBdS075M04 pGCAP10 NM_002745.4  
TGAGGCAGGCAATCGGTCCGAGTGGCTGTCGGCTCTTCAGCTCTCCCGCTCGGCGTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl