RBdS075M04 NRCD Human cDNA Clone

Prev. | Human A to Z list > M > MAPK1 >

RBdS075M04 - NRCD Human cDNA Clone


Catalog Number	HKR430292
Clone Name	RBdS075M04
Clone info.	Plasmid clone of human MAPK1 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	TGAGGCAGGCAATCGGTCCGAGTGGCTGTCGGCTCTTCAGCTCTCCCGCTCGGCGTCTTC
Sequence, submitted⁽³⁾	n.a.
Sequence, refered	NM_002745.4 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	MAPK1 (NCBI Gene 5594) other clone of MAPK1 in our bank
Synonyms	ERK\|ERK-2\|ERK2\|ERT1\|MAPK2\|P42MAPK\|PRKM1\|PRKM2\|p38\|p40\|p41\|p41mapk\|p42-MAPK
Protein Name	mitogen-activated protein kinase 1

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR430292	RBdS075M04	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS075M04 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR430292).

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.