Prev. |  KEGG KO K01074 > 

RIKEN DNA Bank Human Resource - PPT1

Gene ID NCBI Gene 5538 |  KEGG hsa:5538
Gene Symbol PPT1
Protein Name palmitoyl-protein thioesterase 1
Synonyms CLN1|INCL|PPT
Featured content Lysosome (human)
Ortholog resource in our bank

  PPT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088554 IRAL021G10 pDNR-LIB BC008426 NM_000310 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041007 W01A102I15 pENTR-TOPO IRAL021G10 BC008426 NM_000310  
HGE041013 W01A102I21 pENTR-TOPO IRAL021G10 BC008426 NM_000310  
HGE041041 W01A102K01 pENTR-TOPO IRAL021G10 BC008426 NM_000310  
HGE041045 W01A102K05 pENTR-TOPO IRAL021G10 BC008426 NM_000310  
HGE041047 W01A102K07 pENTR-TOPO IRAL021G10 BC008426 NM_000310  
HGE041049 W01A102K09 pENTR-TOPO IRAL021G10 BC008426 NM_000310  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180880 ARi52D08 pGCAP10 NM_000310.3  
GNTGATTCATCGAACATGGCGCCTCCCGGCTGCCTGTGGCTCTGGNCTGTGGCTCTCCTG
HKR332034 RBb30B10 pGCAP1 NM_000310.3  
GACAGCGAAGATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATG
HKR348074 RBb70D02 pGCAP1 NM_000310.3  
GTGACACAGCGAAGATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGC
HKR366481 RBd16D09 pGCAP10 NM_000310.3  
GAGCGAAGATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATGGA
HKR368951 RBd22G07 pGCAP10 NM_000310.3  
HKR409032 RBdS022J16 pGCAP10 NM_000310.3  
GGTGGAGAAGAAAATACCTGGAATTTACGTCTTATCTTTAGAGATTGGGAAGACCCTGAT
HKR430186 RBdS075H18 pGCAP10 NM_000310.3  
GACAGCGAAGATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl