Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075H18

Clone ID RBdS075H18
HP ID HP10138
Gene ID 5538
Gene Symbol PPT1
Protein Name palmitoyl-protein thioesterase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000310.3
Length of RefSeq (bp) 2504
Chromosome 1p32
Reference DDBJ accession
UniGene Hs.3873
5'-terminal sequence GACAGCGAAGATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATG
2011.08.28