Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - POLD2

Gene ID (NCBI) 5425
Gene Symbol POLD2
Protein Name polymerase (DNA directed), delta 2, accessory subunit
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02328)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080577 IRAL001H09 pOTB7 BC000459 NM_006230 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007215 W01A018A15 pENTR-TOPO IRAL001H09 BC000459 NM_006230  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166434 ARi16B10 pGCAP10 NM_006230.2  
GAGGCGCGCGGGGATTGGCGGGATGCAGAGCGCCAGCGCGTGAACCTCCTTGGCCTGGGC
HKR205396 ARiS013I04 pGCAP10 NM_006230.2  
GAGGCGCGCGGGGATTGGCGGGATGCGGCGCGCCGCGCGGGTGAGACATCGGTATCCAGG
HKR364879 RBd12D07 pGCAP10 NM_006230.2  
GATTTGGCGGGATGCGGCGCGCCGCGCGTGAACCTCCTTGGCCTGGGCGAAGCTGTGTGG
HKR342929 RBb57F09 pGCAP1 NM_006230.2  
GGCAGGCGCGCGGGGATTGGCGGGATGCGGCGCGCCGCGCGTTGAACCTCCTTGGCCTGG
HKR345604 RBb64A04 pGCAP1 NM_006230.2  
GGGGGATTGGCGGGATGCGGCGCGCCGCGCGTGAACCTCCTTGGCCTGGGCGAAGCTGTG
HKR348123 RBb70F03 pGCAP1 NM_006230.2  
GGCGGCGCGCCGCGCGTGAACCTCCTTGGCCTGGGCGAAGCTGTGTGGACCAAGCAAGTC
HKR391674 RBd79D02 pGCAP10 NM_006230.2  
GGGCGGGATGCGGCGCGCCGCGCGTGAACCTCCTTGGCCTGGGCGAAGCTGTGTGGACCA
HKR399704 RBd99E08 pGCAP10 NM_006230.2  
GGGGGGGCGCCGCGCGTGAACCTCCTTGGCCTGGGCGAACCTGTGTGGACCNAGCAAGTC
HKR441923 RBdS104N11 pGCAP10 NM_006230.2  
GATTGGCGGGATGCGGCGCGCCGCGCGGGTGAGACATCGGTATCCAGGCACGATAAATTT
HKR475040 RBdS187J24 pGCAP10 NM_006230.2  
GAGGCGCGCGGGGATTGGCGGGATGCGGCGCGCCGCGCGTGAACCTCCTTGGCCTGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl