Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104N11

Clone ID RBdS104N11
HP ID HP04294
Gene ID 5425
Gene Symbol POLD2
Protein Name polymerase (DNA directed), delta 2, regulatory subunit 50kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_006230.2
Length of RefSeq (bp) 1616
Chromosome 7p13
Reference DDBJ accession
UniGene Hs.306791
5'-terminal sequence GATTGGCGGGATGCGGCGCGCCGCGCGGGTGAGACATCGGTATCCAGGCACGATAAATTT
2011.08.28