Prev. |  KEGG KO K17080 > 

RIKEN DNA Bank Human Resource - PHB

Gene ID NCBI Gene 5245 |  KEGG hsa:5245
Gene Symbol PHB
Protein Name prohibitin
Synonyms HEL-215|HEL-S-54e|PHB1
Ortholog resource in our bank

  PHB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084256 IRAL010K16 pOTB7 BC013401 NM_002634 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014060 W01A035C12 pENTR-TOPO IRAL010K16 BC013401 NM_002634  
HGE014064 W01A035C16 pENTR-TOPO IRAL010K16 BC013401 NM_002634  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062811 ARe57A11 pKA1U5 NM_002634.2  
GAGTATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTC
HKR065253 ARe63C05 pKA1U5 NM_002634.2  
GGTATGTGTGGTTGGGGAATTCATGCTGGAGGTCACAGTGGAAGCAGGTGTGAGAGGGTC
HKR065278 ARe63D06 pKA1U5 NM_002634.2  
GGTATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTTGGAAGCAGGTGNGAGAGGTCT
HKR167699 ARi19E03 pGCAP10 NM_002634.2  
GAGTATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTC
HKR222273 ARiS055L09 pGCAP10 NM_002634.2  
GGCAGTATGTGTGGTTGGGGAATTCATGTGGAGGTCANAGTGGAAGCAGGTGTGAGAGGG
HKR235037 ARiS087J21 pGCAP10 NM_002634.2  
GGGGGAATTCATGTGGAGGTCANAGTGGAAGCAGGTGTGAGAGGGTCCAGCAGAAGGAAA
HKR276728 ARiS191N16 pGCAP10 NM_002634.2  
GGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTCCAGCAGAAGGAAA
HKR279438 ARiS198J22 pGCAP10 NM_002634.2  
HKR324898 RBb12E02 pKA1U5 NM_002634.2  
GATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGANGGTCCAGCAGAAGGAAACATGGCTGC
HKR329251 RBb23C03 pGCAP1 NM_002634.2  
GGAAGCAGGTGAGAATGGAGGGGGCGGCAAAGGCTCGTTTCTGGGCATCTCTGCAGTCCT
HKR332180 RBb30H12 pGCAP1 NM_002634.2  
GGTCAGAGTGGAAGCAGGTGTGAGAGGGTCCAGCAGAAGGAAACATGGCTGCCAAAGTGT
HKR334932 RBb37F12 pGCAP1 NM_002634.2  
GGCAGTATGTTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGG
HKR336972 RBb42H04 pGCAP1 NM_002634.2  
TGGATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTCCAGCAGAAGGAAACATGGCT
HKR344529 RBb61F09 pGCAP1 NM_002634.2  
TGGGCAGTATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAG
HKR346450 RBb66C02 pGCAP1 NM_002634.2  
GAGAGTGGAAGCAGGTGTGAGAGGGTCCAGCAGAAGGAAACATGGCTGCCAAAGTGTTTG
HKR367633 RBd19B09 pGCAP10 NM_002634.2  
GGTCGGCGGCGGCGGCGGCAGCGGCTCCGGCCGAGGTGCGCGCTGGGGGGGAGGGGGGGC
HKR380929 RBd52F09 pGCAP10 NM_002634.2  
GATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTCCAG
HKR430298 RBdS075M10 pGCAP10 NM_002634.2  
GAGTATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTC
HKR462684 RBdS156L20 pGCAP10 NM_002634.2  
GANNTNNGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl