Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075M10

Clone ID RBdS075M10
HP ID HP00710
Gene ID 5245
Gene Symbol PHB
Protein Name prohibitin
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002634.2
Length of RefSeq (bp) 1826
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.514303
5'-terminal sequence GAGTATGTGTGGTTGGGGAATTCATGTGGAGGTCAGAGTGGAAGCAGGTGTGAGAGGGTC
2011.08.28