Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PGK1

Gene ID (NCBI) 5230
Gene Symbol PGK1
Protein Name phosphoglycerate kinase 1
Synonyms HEL-S-68p|MIG10|PGKA
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010419 IRAK026A19 pCMV-SPORT6 BC023234 NM_000291 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042003 ARe05A03 pKA1U5 NM_000291.3  
GATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGCTCGGCATCCCTCGATTGACCGAATCA
HKR081251 ARf03C03 pKA1U5 NM_000291.3  
GATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCG
HKR046026 ARe15B02 pKA1U5 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGCTCGGCAGTCGGCTCCCTCGTTGACCG
HKR165226 ARi13B02 pGCAP10 NM_000291.3  
GAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCA
HKR165308 ARi13E12 pGCAP10 NM_000291.3  
GATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCG
HKR166478 ARi16D06 pGCAP10 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR169249 ARi23C01 pGCAP10 NM_000291.3  
CTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCT
HKR055721 ARe39F01 pKA1U5 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR172877 ARi32D05 pGCAP10 NM_000291.3  
GGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGAC
HKR172928 ARi32F08 pGCAP10 NM_000291.3  
GATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCG
HKR056104 ARe40E08 pKA1U5 NM_000291.3  
TTGGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGCTCGGCAGTCGGCTCCCTCGTTGAC
HKR056432 ARe41B08 pKA1U5 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR056882 ARe42D10 pKA1U5 NM_000291.3  
GGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTC
HKR057208 ARe43A08 pKA1U5 NM_000291.3  
GGTGTTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTTCGGCAGTCGGCTCCCTCGTTGA
HKR057750 ARe44G06 pKA1U5 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGCCCGTTNAGATCGGCTCCCTCGATTGA
HKR176856 ARi42C08 pGCAP10 NM_000291.3  
AAACGGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGA
HKR062033 ARe55B09 pKA1U5 NM_000291.3  
ATTTGGTTCCGCATTCTGCAAGCCTCCGGAGCGCACNTTCGGCAGGTCGGCTCCCTCGTT
HKR180931 ARi52F11 pGCAP10 NM_000291.3  
GGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGAC
HKR065379 ARe63H11 pKA1U5 NM_000291.3  
GATTCTGCAAGCCTCCGGAGCGCACGNTCGGCAGCTCGGCATCCCTCGNTTGACCGAATC
HKR186906 ARi67E10 pGCAP10 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGNGCAGTCNGCTCCCTCGTTGACCG
HKR075328 ARe88F08 pKA1U5 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR076873 ARe92D01 pKA1U5 NM_000291.3  
AGGCAAGCCTCCGGAGCGCACGNTCGGCAGTCGGCTCCCTCGATTGACCGAATCACCGAC
HKR076897 ARe92E01 pKA1U5 NM_000291.3  
AGGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCT
HKR203475 ARiS008L11 pGCAP10 NM_000291.3  
GGTCCNNCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR205407 ARiS013I15 pGCAP10 NM_000291.3  
GATTCTNCANNCCTCCNGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCG
HKR208266 ARiS020L02 pGCAP10 NM_000291.3  
GATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCG
HKR209254 ARiS023C06 pGCAP10 NM_000291.3  
GAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCA
HKR234193 ARiS085I01 pGCAP10 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR234253 ARiS085K13 pGCAP10 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR235005 ARiS087I13 pGCAP10 NM_000291.3  
GGTTCCNCATTCTGCANGCCNCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR243923 ARiS109N11 pGCAP10 NM_000291.3  
CGGCCGGCCGATGGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCC
HKR247390 ARiS118H22 pGCAP10 NM_000291.3  
GCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACC
HKR249044 ARiS122K04 pGCAP10 NM_000291.3  
GGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCC
HKR260218 ARiS150J02 pGCAP10 NM_000291.3  
CGGCCGGCCGATGAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGCTGT
HKR260227 ARiS150J11 pGCAP10 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR279214 ARiS198A14 pGCAP10 NM_000291.3  
GGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR322899 RBb07E03 pKA1U5 NM_000291.3  
GCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCT
HKR323276 RBb08D04 pKA1U5 NM_000291.3  
TTGATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCAC
HKR325282 RBb13D10 pKA1U5 NM_000291.3  
AGGATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCAC
HKR364455 RBd11C07 pGCAP10 NM_000291.3  
TGGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACG
HKR332900 RBb32E04 pGCAP1 NM_000291.3  
GGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACC
HKR332956 RBb32G12 pGCAP1 NM_000291.3  
GAGTGTGGGCCCTGNTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGC
HKR386477 RBd66D05 pGCAP10 NM_000291.3  
GGTTCCNNNTTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGA
HKR387202 RBd68A02 pGCAP10 NM_000291.3  
GGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTG
HKR391650 RBd79C02 pGCAP10 NM_000291.3  
GGCGNTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTG
HKR392030 RBd80B06 pGCAP10 NM_000291.3  
GGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCC
HKR398076 RBd95D04 pGCAP10 NM_000291.3  
GGCGGGAGGCGGGGTGTGGGGCGGTAGTGTGGGCCCTGTTCCTGCCCGCGCGGTGTTCCG
HKR409025 RBdS022J09 pGCAP10 NM_000291.3  
GGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACC
HKR475181 RBdS187P21 pGCAP10 NM_000291.3  
GGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl