Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022J09

Clone ID RBdS022J09
HP ID HP00139
Gene ID 5230
Gene Symbol PGK1
Protein Name phosphoglycerate kinase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000291.3
Length of RefSeq (bp) 2439
Chromosome Xq13
Reference DDBJ accession
UniGene Hs.78771
5'-terminal sequence GGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACC
2011.08.28