Prev. |  KEGG KO K00033 > 

RIKEN DNA Bank Human Resource - PGD

Gene ID NCBI Gene 5226 |  KEGG hsa:5226
Gene Symbol PGD
Protein Name phosphogluconate dehydrogenase
Synonyms 6PGD
Ortholog resources KEGG ortholog (KEGG orthology K00033) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080410 IRAL001A10 pOTB7 BC000368 NM_002631 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081236 M01C003B12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081284 M01C003D12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081332 M01C003F12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081380 M01C003H12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081428 M01C003J12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081476 M01C003L12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081524 M01C003N12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE081572 M01C003P12 pDONR221 04-134-2_2-D06 BC000368 NM_002631  
HGE088426 M01C021B02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088474 M01C021D02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088522 M01C021F02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088570 M01C021H02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088618 M01C021J02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088666 M01C021L02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088714 M01C021N02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE088762 M01C021P02 pDONR221 IMS03-D01 BC000368 NM_002631  
HGE099621 M01C049A21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099669 M01C049C21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099717 M01C049E21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099765 M01C049G21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099813 M01C049I21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099861 M01C049K21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099909 M01C049M21 pDONR221 MGC14-A11 BC000368 NM_002631  
HGE099957 M01C049O21 pDONR221 MGC14-A11 BC000368 NM_002631  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247207 ARiS118A07 pGCAP10 NM_002631.2  
AGCTTTCCCTCACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCC
HKR260368 ARiS150P08 pGCAP10 NM_002631.2  
GCTCCTNCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCCCAAGCTGA
HKR276698 ARiS191M10 pGCAP10 NM_002631.2  
GCCCTCANTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGC
HKR326925 RBb17F05 pKA1U5 NM_002631.2  
GACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCCCAAG
HKR327658 RBb19C10 pKA1U5 NM_002631.2  
GGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCCCAAGCTGACATCGCG
HKR336075 RBb40D03 pGCAP1 NM_002631.2  
ACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCCCAAGC
HKR375251 RBd38C03 pGCAP10 NM_002631.2  
GACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCCCAAG
HKR382928 RBd57F08 pGCAP10 NM_002631.2  
GACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCCCAAG
HKR432413 RBdS081A13 pGCAP10 NM_002631.2  
GACTCACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl