Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081A13

Clone ID RBdS081A13
HP ID HP02961
Gene ID 5226
Gene Symbol PGD
Protein Name phosphogluconate dehydrogenase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002631.2
Length of RefSeq (bp) 1937
Chromosome 1p36.3-p36.13
Reference DDBJ accession
UniGene Hs.464071
5'-terminal sequence GACTCACTCGTCCTCCGCGCGTCGCCGCTCTTCGGTTCTGCTCTGTCCGCCGCCATGGCC
2011.08.28