Prev. |  KEGG KO K01099 > 

RIKEN DNA Bank Human Resource - OCRL

Gene ID NCBI Gene 4952 |  KEGG hsa:4952
Gene Symbol OCRL
Protein Name OCRL inositol polyphosphate-5-phosphatase
Synonyms Dent-2|INPP5F|LOCR|NPHL2|OCRL-1|OCRL1
Ortholog resource in our bank

  OCRL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094177 IRAL035H09 pDNR-LIB BC018003 NM_001587 Partial/var
HGY096983 IRAL042H15 pOTB7 BC025253 NM_001587 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162972 ARi07H04 pGCAP10 NM_000276.3  
CTCTCAGCTCCCAGCTCCCCGCTCCCGGCTCCCGGCGCCCGGCGCCCGGCGCGGAGCTGT
HKR165649 ARi14C01 pGCAP10 NM_000276.3  
GCTCTCTTGGGTCAGATTCTCAGCTCCCAGCTCCCCGCTCCCGGCTCCCGGCGCCCGGCG
HKR430141 RBdS075F21 pGCAP10 NM_000276.3  
GGGCTCCCGGCGCCCGGCGCCCGGCGCGGAGCTGTTCCTCAAACGACACGCAGCCGAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl