Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075F21

Clone ID RBdS075F21
HP ID HP06897
Gene ID 4952
Gene Symbol OCRL
Protein Name oculocerebrorenal syndrome of Lowe
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000276.3
Length of RefSeq (bp) 5165
Chromosome Xq25-q26.1
Reference DDBJ accession
UniGene Hs.126357
5'-terminal sequence GGGCTCCCGGCGCCCGGCGCCCGGCGCGGAGCTGTTCCTCAAACGACACGCAGCCGAGGT
2011.08.28