Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NEUROD1

Gene ID (NCBI) 4760
Gene Symbol NEUROD1
Protein Name neuronal differentiation 1
Synonyms BETA2|BHF-1|MODY6|NEUROD|bHLHa3
Databases KEGG hsa:4760 |  NCBI Gene 4760
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08033)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15474 AdEFLhNeuroL-4FVF Recombinant adenovirus expressing human NeuroD1 cDNA, EF1 promoter.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005509 IRAK013M21 pCMV-SPORT6(a) BC009046 NM_002500 Full/var

(1) Please refer Vector Information and Library Method Overviews at MGC.
(a)Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001380 W01A003H12 pENTR-TOPO IRAK013M21 BC009046 NM_002500 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324833 RBb12B09 pKA1U5 NM_002500.2  
ACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTAT
HKR332145 RBb30G01 pGCAP1 NM_002500.2  
GACACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGAC
HKR365325 RBd13F05 pGCAP10 NM_002500.2  
GACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTA
HKR380145 RBd50G01 pGCAP10 NM_002500.2  
GACACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGAC
HKR390949 RBd77G05 pGCAP10 NM_002500.2  
GACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTA
HKR394576 RBd86H08 pGCAP10 NM_002500.2  
GACGAGGAATTCGCCCACGCGGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTA
HKR432488 RBdS081D16 pGCAP10 NM_002500.2  
GGCCCGCGCTTAGCATCACTAACTGGGCTATATAACCTGAGCGCCCGCGCGGCCACGACA
HKR442328 RBdS105N16 pGCAP10 NM_002500.2  
GACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTA
HKR444056 RBdS110C08 pGCAP10 NM_002500.2  
GACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.02.26

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl