Prev. |  Human A to Z list >  N >  NEUROD1 > 

RBb12B09 - NRCD Human cDNA Clone

Catalog Number HKR324833
Clone Name RBb12B09
Clone info. Plasmid clone of human NEUROD1 cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) ACGAGGAATTCGCCCACGCAGGAGGCACGGCGTCCGGAGGCCCCAGGGTTATGAGACTAT
Sequence, submitted(3) AB593068 [link]
Note Full cds with aa substitution when compared using AB593068
 
Sequence, refered NM_002500.5 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) NEUROD1 (NCBI Gene 4760)  other clone of NEUROD1 in our bank
Synonyms BETA2|BHF-1|MODY6|NEUROD|T2D|bHLHa3
Protein Name neuronal differentiation 1
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR324833 RBb12B09 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBb12B09 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR324833).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl