Prev. |  KEGG KO K03953 > 

RIKEN DNA Bank Human Resource - NDUFA9

Gene ID NCBI Gene 4704 |  KEGG hsa:4704
Gene Symbol NDUFA9
Protein Name NADH:ubiquinone oxidoreductase subunit A9
Synonyms CC6|CI-39k|CI39k|COQ11|MC1DN26|NDUFS2L|SDR22E1
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFA9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001249 IRAK003C01 pCMV-SPORT6 BC003351 NM_005002 Partial
HGY090418 IRAL026A18 pOTB7 BC009311 NM_005002
HGY095231 IRAL038B07 pDNR-LIB BC015837 NM_005002 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099229 M01C048B05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099277 M01C048D05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099325 M01C048F05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099373 M01C048H05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099421 M01C048J05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099469 M01C048L05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099517 M01C048N05 pDONR221 MGC13-G03 BC009311 NM_005002  
HGE099565 M01C048P05 pDONR221 MGC13-G03 BC009311 NM_005002  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071252 ARe78C04 pKA1U5 NM_005002.3  
GGTGGGAAAAGATGGCGGCTGCCGCACAATCCCGGGTTGTCCGGGTCCTGTCAATGTCAC
HKR276610 ARiS191I18 pGCAP10 NM_005002.3  
GGTGTGGGAAAAGATGGCGGCTGCCGCACAATCCCGGGTTGTCCGGGTCCTGTCAATGTC
HKR376056 RBd40C08 pGCAP10 NM_005002.3  
GGTGGGAAAAGATGGCGGCTGCCGCACAATCCCGGGTTGTCCGGGTCCTGTCAATGTCAC
HKR420461 RBdS051C13 pGCAP10 NM_005002.3  
AAAAGATGGCGGCTGCCGCACAATCCCGGGTTGTCCGGGTCCTGTCAATGTCACGTTCTG
HKR441634 RBdS104B10 pGCAP10 NM_005002.3  
GGAGAAAGGTAAGTTTTGACCCAGCTTAGCAGCCGTAGTCAGCCGGGAGTGCTGTCGTGG
HKR470996 RBdS177I04 pGCAP10 NM_005002.3  
GATTGTGGGAAAAGATGGCGGCTGCCGCACAATCCCGGGTTGTCCGGGTCCTGTCAATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl