Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104B10

Clone ID RBdS104B10
HP ID HP00240
Gene ID 4704
Gene Symbol NDUFA9
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005002.3
Length of RefSeq (bp) 1334
Chromosome 12p13.3
Reference DDBJ accession
UniGene Hs.75227
5'-terminal sequence GGAGAAAGGTAAGTTTTGACCCAGCTTAGCAGCCGTAGTCAGCCGGGAGTGCTGTCGTGG
2011.08.28