Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MYCN

Gene ID (NCBI) 4613
Gene Symbol MYCN
Protein Name MYCN proto-oncogene, bHLH transcription factor
Synonyms MODED|N-myc|NMYC|ODED|bHLHe37
Databases KEGG hsa:4613 |  NCBI Gene 4613
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09109)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07820 pGL4-phMYCN Promoter collection, Human MYCN promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084852 IRAL012C04 pOTB7 BC002712 NM_005378 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320404 RBb01A04 pKA1U5 NM_005378.4  
GAGGCACAACTTCCTCCACCTTCGGGAGCAGTGGGCAGAGTGGGGGGCTTGGAGGGAAGA
HKR322078 RBb05D06 pKA1U5 NM_005378.4  
GGAGGCACAACTTCCTCCACCTTCGGGAGCAGCTGCGGNAGAGNTGGGGGGCTTGGAGGG
HKR326902 RBb17E06 pKA1U5 NM_005378.4  
GCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCGAGCAAGCG
HKR327307 RBb18E11 pKA1U5 NM_005378.4  
GAGTCGCCGGCCGGGAGGCGAGCCGATGCCGAGCTGCTCCACGTCCACCATGCCGGGCAT
HKR332884 RBb32D12 pGCAP1 NM_005378.4  
GATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCGAG
HKR333655 RBb34C07 pGCAP1 NM_005378.4  
TTGGGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATCCCNTNNGCTCCTGGGAACTGT
HKR334551 RBb36G07 pGCAP1 NM_005378.4  
GGGAACTGTGTTGGAGCCGAGCAAGCGCTAGCCAGGCGCAAGCGCGCACAGACTGTAGCC
HKR340127 RBb50F07 pGCAP1 NM_005378.4  
GACCCTTCTTCCGGGGATGATCTGTCGGTTTGCAGATGTTTGGAAGGCTCGGTTNCCGGC
HKR346497 RBb66E01 pGCAP1 NM_005378.4  
GAGAGGCACAACTTCCTCCACCTTCGGGAGCAGTGGGCAGAGTGGGGGGCTTGGAGGGAA
HKR360525 RBd01F05 pGCAP10 NM_005378.4  
TGAAAAGCGCAGGCTGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTC
HKR361728 RBd04F08 pGCAP10 NM_005378.4  
GAGAGGGGGCGCCCATTGCCTATCCCCTCGGTCTGCCCCGTTTGCCCACCCTCTCCGGTG
HKR370130 RBd25F10 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT
HKR370149 RBd25G05 pGCAP10 NM_005378.4  
GGCAGGCTGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAA
HKR371374 RBd28H06 pGCAP10 NM_005378.4  
TGGATCCCCCGAGCTGGGTCACGGAGATGCTGCTTGAGAACGAGCTGTGGGGCAGCCCGG
HKR378175 RBd45H07 pGCAP10 NM_005378.4  
GGGCACNTTTTCCTCCACCTTCGGGAGCAGTGGGCAGAGTGGGGGGCTTGGAGGGAAGAT
HKR378548 RBd46G04 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACCCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT
HKR386434 RBd66B10 pGCAP10 NM_005378.4  
GAGTCNNNNGCCGGGAGGCGAGCCGATGCCGAGCTGCTCCACGTCCACCATGCCGGGCAT
HKR387350 RBd68G06 pGCAP10 NM_005378.4  
GGACNNTCNTCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTTGG
HKR394931 RBd87F11 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT
HKR405222 RBdS013A22 pGCAP10 NM_005378.4  
GAGCCGTGGCTTCGCGGAGCACAGCTCCGAGCCCCCGAGCTGGGTCACGGAGATGCTGCT
HKR405610 RBdS014A10 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT
HKR405702 RBdS014E06 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT
HKR405746 RBdS014G02 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT
HKR430069 RBdS075C21 pGCAP10 NM_005378.4  
GAGGCTGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACT
HKR433314 RBdS083E18 pGCAP10 NM_005378.4  
GNGGCACAACTTCCTCCACCTTCNGGAGCAGTGGGCAGAGTGGGGGGCTTGGAGGGAAGA
HKR433392 RBdS083H24 pGCAP10 NM_005378.4  
GGTGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTG
HKR444287 RBdS110L23 pGCAP10 NM_005378.4  
GAGGCTGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACT
HKR461750 RBdS154G06 pGCAP10 NM_005378.4  
GGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACTGTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl