Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110L23

Clone ID RBdS110L23
HP ID HP05165
Gene ID 4613
Gene Symbol MYCN
Protein Name v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005378.4
Length of RefSeq (bp) 2613
Chromosome 2p24.1
Reference DDBJ accession
UniGene Hs.25960
5'-terminal sequence GAGGCTGTGACAGTCATCTGTCTGGACGCGCTGGGTGGATGCGGGGGGCTCCTGGGAACT
2011.08.28